Stem-loop sequence ipu-let-7d-2

AccessionMI0024444 (change log)
DescriptionIctalurus punctatus let-7d-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7d-2
(5 sentences)

Stem-loop
   --u   g   uu            uu  au  uaa 
5'    gag uag  gguuguaugguu  gc  ca   u
      ||| |||  ||||||||||||  ||  ||   c
3'    uuc auc  ccaacaugucaa  ug  gu   a
   ccu   g   uu            -u  ag  ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7d

Accession MIMAT0029377
Sequence

1 - 

ugagguaguugguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1