Stem-loop sequence ipu-let-7d-1

AccessionMI0024445 (change log)
DescriptionIctalurus punctatus let-7d-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7d-1
(5 sentences)

Stem-loop
   --u   g   uu            uu  auaauaa 
5'    gag uag  gguuguaugguu  gc       a
      ||| |||  ||||||||||||  ||       c
3'    uuc auc  ccaacaugucaa  ug       a
   ccu   g   uu            -u  aggcccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7d

Accession MIMAT0029377
Sequence

1 - 

ugagguaguugguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1