Stem-loop sequence ipu-let-7e-1

AccessionMI0024447 (change log)
DescriptionIctalurus punctatus let-7e-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7e-1
(5 sentences)

Stem-loop
   -u   gu         a        ---------     c 
5'   gag  aguagauug auaguugu         ggagc c
     |||  ||||||||| ||||||||         ||||| u
3'   uuc  ucaucuaac uaucaaua         ucucg g
   cu   ug         a        gagucucuc     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7e

Accession MIMAT0029378
Sequence

1 - 

ugagguaguagauugaauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1