Stem-loop sequence ipu-let-7f

AccessionMI0024448 (change log)
DescriptionIctalurus punctatus let-7f stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7f
(5 sentences)

Stem-loop
   -u                       ---------       u 
5'   gagguaguagauuguauaguugu         aggguag g
     |||||||||||||||||||||||         ||||||| a
3'   uuccguuaucuaacauaucaaua         uccuauu u
   cc                       gaagaugug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7f

Accession MIMAT0029379
Sequence

1 - 

ugagguaguagauuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1