Stem-loop sequence ipu-let-7g-1

AccessionMI0024449 (change log)
DescriptionIctalurus punctatus let-7g-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7g-1
(5 sentences)

Stem-loop
   --u   gu     u          ----- g     ac 
5'    gag  aguag uuguauaguu     u ggauc  a
      |||  ||||| ||||||||||     | |||||   
3'    uuc  ucauc gacauaucaa     g ucuag  c
   ucu   ug     c          uagag g     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7g

Accession MIMAT0029380
Sequence

1 - 

ugagguaguaguuuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1