Stem-loop sequence ipu-let-7h

AccessionMI0024451 (change log)
DescriptionIctalurus punctatus let-7h stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7h
(5 sentences)

Stem-loop
   -u                 u      -------    a   gua 
5'   gagguaguaaguugugu guuguu       gggg uca   u
     ||||||||||||||||| ||||||       |||| |||    
3'   uuccgucauuuaacaua caauag       uccc ggu   a
   cc                 u      aggaagu    -   aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7h

Accession MIMAT0029381
Sequence

1 - 

ugagguaguaaguuguguuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1