Stem-loop sequence ipu-let-7i

AccessionMI0024452 (change log)
DescriptionIctalurus punctatus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7i
(5 sentences)

Stem-loop
   -u    u            u    g  ggga      au 
5'   gagg aguaguuugugc guug uu    ugugac  u
     |||| |||||||||||| |||| ||    ||||||  g
3'   uucc ucaucgaacgcg cagu ag    guauug  c
   cg    c            u    -  --ag      cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7i

Accession MIMAT0029382
Sequence

1 - 

ugagguaguaguuugugcuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1