Stem-loop sequence ipu-let-7j-1

AccessionMI0024453 (change log)
DescriptionIctalurus punctatus let-7j-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7j-1
(5 sentences)

Stem-loop
   -u        u            --------uu      cu u 
5'   gagguagu guuuguacaguu          uagggu  g u
     |||||||| ||||||||||||          ||||||  | a
3'   uuccguca cagacaugucaa          gucccg  c u
   cg        u            ucgaggaauu      -u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7j

Accession MIMAT0029383
Sequence

1 - 

ugagguaguuguuuguacaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1