Stem-loop sequence ipu-mir-101a

AccessionMI0024458 (change log)
DescriptionIctalurus punctatus miR-101a stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention ipu-mir-101a
(1 sentences)

Stem-loop
   --                  a    gucca 
5'   ucaguuaucacagugcug ugcu     u
     |||||||||||||||||| ||||      
3'   agucaauagugucaugac augg     c
   ga                  -    aaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-101a

Accession MIMAT0029386
Sequence

38 - 

uacaguacugugauaacugaag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1