Stem-loop sequence ipu-mir-153b

AccessionMI0024517 (change log)
DescriptionIctalurus punctatus miR-153b stem-loop
Gene family MIPF0000050; mir-153
Literature search

1 open access papers mention ipu-mir-153b
(2 sentences)

Stem-loop
   --           gu -       a uagu 
5'   ucauuuuugug  u ugcagcu g    c
     |||||||||||  | ||||||| |     
3'   aguaaaaacac  a acguuga c    u
   cg           ug u       c uugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-153b

Accession MIMAT0029428
Sequence

38 - 

uugcauagucacaaaaaugagc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1