Stem-loop sequence ipu-mir-181a-4

AccessionMI0024529 (change log)
DescriptionIctalurus punctatus miR-181a-4 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181a-4
(5 sentences)

Stem-loop
   --a   uu     cu       a     gau 
5'    aca  caacg  gucggug guuug   g
      |||  |||||  ||||||| |||||   c
3'    ugu  guugc  cagcuac caaau   a
   ccg   cg     --       -     aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181a

Accession MIMAT0029436
Sequence

1 - 

aacauucaacgcugucggugag

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1