Stem-loop sequence ipu-mir-181b-2

AccessionMI0024531 (change log)
DescriptionIctalurus punctatus miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181b-2
(4 sentences)

Stem-loop
   -aa         cug          gga  g 
5'    cauucauug   ucgguggguu   uu u
      |||||||||   ||||||||||   ||  
3'    guaaguaac   agucacucga   aa a
   aac         --a          aag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181b

Accession MIMAT0029437
Sequence

1 - 

aacauucauugcugucgguggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1