Stem-loop sequence ipu-mir-462

AccessionMI0024640 (change log)
DescriptionIctalurus punctatus miR-462 stem-loop
Gene family MIPF0001755; mir-462
Literature search

1 open access papers mention ipu-mir-462
(5 sentences)

Stem-loop
   --ua      c     au       u ug   g 
5'     acggaa ccaua  gcagcug u  guu a
       |||||| |||||  ||||||| |  |||  
3'     ugccuu ggugu  ugucgac a  uag u
   cccg      a     -c       - gu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-462

Accession MIMAT0029519
Sequence

1 - 

uaacggaacccauaaugcagcug

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1