Stem-loop sequence ipu-mir-9-4

AccessionMI0024657 (change log)
DescriptionIctalurus punctatus miR-9-4 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-4
(5 sentences)

Stem-loop
   --uc       a       g     -   u 
5'     uuugguu ucuagcu uauga guu a
       ||||||| ||||||| ||||| ||| u
3'     aagccaa agaucga auacu uag g
   augu       g       a     a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1