Stem-loop sequence ipu-mir-9-6

AccessionMI0024659 (change log)
DescriptionIctalurus punctatus miR-9-6 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-6
(5 sentences)

Stem-loop
   --uc               g      u  uu 
5'     uuugguuaucuagcu uaugag gu  a
       ||||||||||||||| |||||| ||   
3'     aagccaauagaucga auacuu cg  u
   auga               a      c  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1