Stem-loop sequence ipu-mir-9-3

AccessionMI0024661 (change log)
DescriptionIctalurus punctatus miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-3
(5 sentences)

Stem-loop
   -uc               g     --  ua 
5'    uuugguuaucuagcu uauga  gu  u
      ||||||||||||||| |||||  ||   
3'    aagccaauagaucga auacu  ca  a
   uga               a     gu  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1