Stem-loop sequence ipu-mir-203c

AccessionMI0024677 (change log)
DescriptionIctalurus punctatus miR-203c stem-loop
Gene family MIPF0000108; mir-203
Literature search

1 open access papers mention ipu-mir-203c
(1 sentences)

Stem-loop
   --      c  a    u    -  a       
5'   aguggu cu aaca uuca ca uuuuga 
     |||||| || |||| |||| || ||||| g
3'   ucacca ga uugu aagu gu aagaua 
   cg      a  a    c    u  c       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-203c

Accession MIMAT0029541
Sequence

39 - 

uugaacuguuaagaaccacugc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1