Stem-loop sequence ipu-mir-129b

AccessionMI0024680 (change log)
DescriptionIctalurus punctatus miR-129b stem-loop
Gene family MIPF0000073; mir-129
Literature search

1 open access papers mention ipu-mir-129b
(1 sentences)

Stem-loop
   --    g   aa      c   gcua  gg 
5'   uuug ggu  gggcuu cug    cu  u
     |||| |||  |||||| |||    ||   
3'   aaac cca  cccgaa gac    ga  u
   aa    g   ga      c   -aag  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-129b

Accession MIMAT0029544
Sequence

1 - 

uuugggguaagggcuuccuggcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1