Stem-loop sequence ipu-mir-7553

AccessionMI0024685 (change log)
DescriptionIctalurus punctatus miR-7553 stem-loop
Literature search

1 open access papers mention ipu-mir-7553
(2 sentences)

Stem-loop
   --u a     uu     --c   --a -      
5'    g cguca  agcga   ccg   c cuauu 
      | |||||  |||||   |||   | |||| g
3'    c gcagu  ucgcu   ggc   g gauag 
   ucg c     cu     acc   aca a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7553

Accession MIMAT0029549
Sequence

1 - 

ugacgucauuagcgacccgacc

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1