Stem-loop sequence ipu-mir-7562

AccessionMI0024695 (change log)
DescriptionIctalurus punctatus miR-7562 stem-loop
Literature search

1 open access papers mention ipu-mir-7562
(1 sentences)

Stem-loop
   --c   c    u           a    gcu 
5'    aca acac caugaacacac cugu   u
      ||| |||| ||||||||||| ||||    
3'    ugu ugug guauuugugug ggua   c
   cuc   u    c           -    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7562

Accession MIMAT0029559
Sequence

1 - 

cacacacacucaugaacacaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1