Stem-loop sequence ipu-mir-7568

AccessionMI0024703 (change log)
DescriptionIctalurus punctatus miR-7568 stem-loop
Literature search

1 open access papers mention ipu-mir-7568
(2 sentences)

Stem-loop
   --     uuu  gucu   u   u   u 
5'   ucagc   cu    guc guc guc g
     |||||   ||    ||| ||| ||| u
3'   agucg   ga    cag cag cag c
   ua     --u  --ac   c   u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7568

Accession MIMAT0029567
Sequence

33 - 

cugaccgaccaagugcugaau

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1