Stem-loop sequence ipu-mir-7569

AccessionMI0024704 (change log)
DescriptionIctalurus punctatus miR-7569 stem-loop
Literature search

1 open access papers mention ipu-mir-7569
(2 sentences)

Stem-loop
   --           ---      u c    uugu    c 
5'   uauaaucuuga   uguuuc c auuu    gugg u
     |||||||||||   |||||| | ||||    |||| u
3'   auguuagaacu   acaaag g uaag    cgcu c
   ca           ucu      u u    uguu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7569

Accession MIMAT0029568
Sequence

1 - 

uauaaucuugauguuucucca

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1