Stem-loop sequence ipu-mir-7570

AccessionMI0024705 (change log)
DescriptionIctalurus punctatus miR-7570 stem-loop
Literature search

1 open access papers mention ipu-mir-7570
(2 sentences)

Stem-loop
   --c           g  guug         c 
5'    gugccggugcg ca    gagaaggag g
      ||||||||||| ||    |||||||||  
3'    cacggccgcgu gu    uucuuccuu a
   ucu           -  ---a         u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7570

Accession MIMAT0029569
Sequence

37 - 

uucuuaugugcgccggcacucu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1