Stem-loop sequence ipu-mir-7571

AccessionMI0024706 (change log)
DescriptionIctalurus punctatus miR-7571 stem-loop
Literature search

1 open access papers mention ipu-mir-7571
(2 sentences)

Stem-loop
   --ga      aa  -   a uc   ucgac 
5'     gguggu  ca gua c  gac     a
       ||||||  || ||| |  |||     a
3'     ccacca  gu cau g  cug     u
   aguc      ca  a   c ga   uacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7571

Accession MIMAT0029570
Sequence

38 - 

caggcuacaugacaccacccuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1