Stem-loop sequence ipu-mir-7573

AccessionMI0024708 (change log)
DescriptionIctalurus punctatus miR-7573 stem-loop
Literature search

1 open access papers mention ipu-mir-7573
(2 sentences)

Stem-loop
   ------a       ccugau   -ac      -   u     
5'        ggcugag      ggc   ugaggu ggc gaua 
          |||||||      |||   |||||| ||| ||| a
3'        ccgacuc      ccg   acucca ccg cuaa 
   cguacag       --aagu   guu      u   -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7573

Accession MIMAT0029572
Sequence

1 - 

aggcugagccugauggcacugag

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1