Stem-loop sequence ipu-mir-7574

AccessionMI0024709 (change log)
DescriptionIctalurus punctatus miR-7574 stem-loop
Literature search

1 open access papers mention ipu-mir-7574
(2 sentences)

Stem-loop
   --  a        a   c  c    guu 
5'   ac agugagua aga ag acgg   a
     || |||||||| ||| || ||||   u
3'   ug ucgcucau ucu uu ugcc   g
   uc  c        c   a  -    aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7574

Accession MIMAT0029573
Sequence

36 - 

uuuaucucuacucgcucgucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1