Stem-loop sequence ipu-mir-7576

AccessionMI0024711 (change log)
DescriptionIctalurus punctatus miR-7576 stem-loop
Literature search

1 open access papers mention ipu-mir-7576
(2 sentences)

Stem-loop
   --       u       c     - cc 
5'   ugcggcg uugaaug ucucc c  u
     ||||||| ||||||| ||||| |   
3'   acgccgc aacuuac agagg g  g
   ac       c       a     c ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7576

Accession MIMAT0029575
Sequence

33 - 

agaacauucaaccgccgcaca

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1