Stem-loop sequence ipu-mir-7577

AccessionMI0024712 (change log)
DescriptionIctalurus punctatus miR-7577 stem-loop
Literature search

1 open access papers mention ipu-mir-7577
(2 sentences)

Stem-loop
   --     acauu   gac      a 
5'   cucgg     uug   ucggaa u
     |||||     |||   ||||||  
3'   gagcu     gac   agccuu g
   cu     -----   auu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7577

Accession MIMAT0029576
Sequence

1 - 

cucggacauuuuggacucgga

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1