Stem-loop sequence cbr-mir-124b

AccessionMI0024744 (change log)
DescriptionCaenorhabditis briggsae miR-124b stem-loop
Literature search

2 open access papers mention cbr-mir-124b
(21 sentences)

Stem-loop
   --        u u   u  g       a  aa 
5'   acagaguu g cgu gc uuuaauu gg  c
     |||||||| | ||| || ||||||| ||  a
3'   ugucucaa c gca cg gaauuaa cc  g
   uc        u c   -  -       a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 1605243-1605305 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-124b
cbr-mir-124cchrX: 1609141-1609202 [-]
cbr-mir-124bchrX: 1605243-1605305 [-]
Database links

Mature sequence cbr-miR-124b

Accession MIMAT0029607
Sequence

42 - 

uaaggcacgccuaacucugucu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1