Stem-loop sequence cbr-mir-124c

AccessionMI0024745 (change log)
DescriptionCaenorhabditis briggsae miR-124c stem-loop
Literature search

2 open access papers mention cbr-mir-124c
(21 sentences)

Stem-loop
   --     a    c    a       a   aac 
5'   acggc uugg agug ccuuaau gag   a
     ||||| |||| |||| ||||||| |||   g
3'   ugccg aacc ucac ggaauua cuc   u
   ca     -    u    -       -   aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 1609141-1609202 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-124c
cbr-mir-124cchrX: 1609141-1609202 [-]
cbr-mir-124bchrX: 1605243-1605305 [-]
Database links

Mature sequence cbr-miR-124c

Accession MIMAT0029608
Sequence

42 - 

uaaggcacuuccaagccguac

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1