Stem-loop sequence cbr-mir-785b

AccessionMI0024746 (change log)
DescriptionCaenorhabditis briggsae miR-785b stem-loop
Stem-loop
   --a    u     uauu   u      c  - a 
5'    gaag uagag    uuc cuuagc aa c c
      |||| |||||    ||| |||||| || | a
3'    cuuc aucuc    aag gaaucg uu g u
   ugg    c     --uu   u      c  a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4421255-4421318 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-785b
cbr-mir-75chrX: 4419739-4419830 [-]
cbr-mir-785bchrX: 4421255-4421318 [+]
cbr-mir-74achrX: 4426602-4426682 [-]
cbr-mir-74bchrX: 4426711-4426827 [-]
cbr-mir-73achrX: 4426887-4426980 [-]
cbr-mir-2231chrX: 4430575-4430638 [-]
Database links

Mature sequence cbr-miR-785b

Accession MIMAT0029609
Sequence

42 - 

uaagugaauucucuaccuucggu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1