Stem-loop sequence cbn-mir-7620a

AccessionMI0024803 (change log)
DescriptionCaenorhabditis brenneri miR-7620a stem-loop
Stem-loop
   --           u  u       uauugaa 
5'   uauuguaggac ug auuuauc       a
     ||||||||||| || |||||||       u
3'   auaacguuuug ac uaaauag       u
   ca           u  -       uauuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig308: 16622-16683 [-]
intergenic
Database links

Mature sequence cbn-miR-7620a

Accession MIMAT0029659
Sequence

1 - 

uauuguaggacuuguauuuauc

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1