Stem-loop sequence cbn-mir-7622

AccessionMI0024806 (change log)
DescriptionCaenorhabditis brenneri miR-7622 stem-loop
Stem-loop
   --          au  u c       --aaaa  u 
5'   ucaauucagg  gg g auaugug      cg g
     ||||||||||  || | |||||||      ||  
3'   aguuaggucc  cc c uauacac      gc c
   uc          au  - u       acauaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig77: 293846-293912 [+]
intergenic
Database links

Mature sequence cbn-miR-7622

Accession MIMAT0029662
Sequence

1 - 

ucaauucaggauggugcauaugu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1