Stem-loop sequence cbn-mir-789b

AccessionMI0024807 (change log)
DescriptionCaenorhabditis brenneri miR-789b stem-loop
Stem-loop
   --        cuu     c  a   ucuaa 
5'   cgaguggu   ccagg ug gca     a
     ||||||||   ||||| || |||      
3'   gcucacca   ggucc ac cgu     a
   cu        cau     u  -   uuuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig30: 204628-204686 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-789b
cbn-mir-789aCbre_Contig30: 201790-201848 [+]
cbn-mir-789bCbre_Contig30: 204628-204686 [+]
Database links

Mature sequence cbn-miR-789b

Accession MIMAT0029663
Sequence

38 - 

ccauccugguacaccacucguc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1