Stem-loop sequence cbn-mir-789a

AccessionMI0024808 (change log)
DescriptionCaenorhabditis brenneri miR-789a stem-loop
Stem-loop
   ---       c          a   uc  a 
5'    gauuggu auccaggcgg gca  uc g
      ||||||| |||||||||| |||  ||  
3'    uuaacca uggguccguc cgu  gg a
   cug       c          c   uc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig30: 201790-201848 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-789a
cbn-mir-789aCbre_Contig30: 201790-201848 [+]
cbn-mir-789bCbre_Contig30: 204628-204686 [+]
Database links

Mature sequence cbn-miR-789a

Accession MIMAT0029664
Sequence

37 - 

cccugccugggucaccaauuguc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1