Stem-loop sequence cbn-mir-7625

AccessionMI0024811 (change log)
DescriptionCaenorhabditis brenneri miR-7625 stem-loop
Stem-loop
   --  g  c                  --c   c 
5'   gg ac uucaauucguucagagag   aag u
     || || ||||||||||||||||||   |||  
3'   cc ug aaguuggguaagucucuc   uuc u
   ca  g  u                  aaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig154: 72003-72066 [+]
intergenic
Database links

Mature sequence cbn-miR-7625

Accession MIMAT0029667
Sequence

1 - 

gggaccuucaauucguucagaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1