Stem-loop sequence cbn-mir-7626

AccessionMI0024812 (change log)
DescriptionCaenorhabditis brenneri miR-7626 stem-loop
Stem-loop
   --         a u   u       - aaa 
5'   agggugaag g ugc cuccauu c   a
     ||||||||| | ||| ||||||| |    
3'   ucucauuuc c aug gagguaa g   c
   ag         - c   -       a caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig205: 209870-209926 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-7626
cbn-mir-1824bCbre_Contig205: 202140-202207 [-]
cbn-mir-7638Cbre_Contig205: 203997-204059 [-]
cbn-mir-239c-1Cbre_Contig205: 208108-208173 [+]
cbn-mir-239d-1Cbre_Contig205: 208242-208301 [+]
cbn-mir-7626Cbre_Contig205: 209870-209926 [+]
cbn-mir-7615-1Cbre_Contig205: 210681-210744 [+]
Database links

Mature sequence cbn-miR-7626

Accession MIMAT0029668
Sequence

37 - 

uggagguacccuuuacucuga

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1