Stem-loop sequence cbn-mir-7632

AccessionMI0024819 (change log)
DescriptionCaenorhabditis brenneri miR-7632 stem-loop
Stem-loop
   ---         ucc     uc       a 
5'    uugauauug   gggua  ggucucc c
      |||||||||   |||||  ||||||| u
3'    aacuguaac   cccau  ccagagg c
   uca         uac     --       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig68: 286710-286767 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-7632
cbn-mir-7628Cbre_Contig68: 286417-286473 [+]
cbn-mir-7619Cbre_Contig68: 286553-286612 [+]
cbn-mir-7632Cbre_Contig68: 286710-286767 [+]
Database links

Mature sequence cbn-miR-7632

Accession MIMAT0029675
Sequence

1 - 

uugauauuguccggguaucggucu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1