Stem-loop sequence cbn-mir-84

AccessionMI0024825 (change log)
DescriptionCaenorhabditis brenneri miR-84 stem-loop
Stem-loop
   --u   g    uug      c   c    - a 
5'    gag uagu   gaaaug ugu gacg c u
      ||| ||||   |||||| ||| |||| | u
3'    cuc auca   cuuuac aca cugu g g
   cgg   a    --a      a   a    a u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig8: 1223147-1223208 [+]
intergenic
Database links

Mature sequence cbn-miR-84

Accession MIMAT0029681
Sequence

1 - 

ugagguaguuuggaaaugcugucg

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1