Stem-loop sequence cbn-let-7

AccessionMI0024826 (change log)
DescriptionCaenorhabditis brenneri let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention cbn-let-7
(1 sentences)

Stem-loop
   --        u  g            gaauca 
5'   ugagguag ag uuguauaguuua      u
     |||||||| || ||||||||||||       
3'   acuccauc uc aacguaucaagu      a
   cc        u  g            ggcccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig2: 1723907-1723970 [+]
intergenic
Database links

Mature sequence cbn-let-7

Accession MIMAT0029682
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1