Stem-loop sequence cbn-mir-48-2

AccessionMI0024828 (change log)
DescriptionCaenorhabditis brenneri miR-48-2 stem-loop
Gene family MIPF0000235; mir-48
Stem-loop
   --u    u    uc   a    c   -c  aa   ag 
5'    gagg aggc  agu gaug gaa  gu  aug  c
      |||| ||||  ||| |||| |||  ||  |||   
3'    cucc uccg  uca cuac cuu  cg  uac  c
   ccg    u    -u   c    a   uc  gc   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig3523: 3778-3849 [-]
intergenic
Database links

Mature sequence cbn-miR-48

Accession MIMAT0029683
Sequence

1 - 

ugagguaggcucaguagaugcga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1