Stem-loop sequence cbn-mir-241-2

AccessionMI0024832 (change log)
DescriptionCaenorhabditis brenneri miR-241-2 stem-loop
Gene family MIPF0000248; mir-241
Stem-loop
   --a       g  c    -     -   ---  a 
5'    gagguag ug gaga aauga cgg   gc u
      ||||||| || |||| ||||| |||   || c
3'    cuucauc ac cucu uuacu gcu   cg g
   caa       g  c    g     u   aaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig2554: 5054-5117 [+]
intergenic
Database links

Mature sequence cbn-miR-241

Accession MIMAT0029685
Sequence

1 - 

agagguaggugcgagaaauga

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1