Stem-loop sequence cbn-mir-54

AccessionMI0024835 (change log)
DescriptionCaenorhabditis brenneri miR-54 stem-loop
Gene family MIPF0000874; mir-54
Stem-loop
   ---   a     -  gg   a     uug   uc 
5'    ggg uauga ga  acg guaca   aau  a
      ||| ||||| ||  ||| |||||   |||   
3'    ccu auacu cu  ugc caugu   uua  a
   gag   a     u  aa   c     uca   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig2: 2465213-2465278 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-54
cbn-mir-54Cbre_Contig2: 2465213-2465278 [+]
cbn-mir-55Cbre_Contig2: 2465352-2465412 [+]
cbn-mir-56Cbre_Contig2: 2465487-2465545 [+]
Database links

Mature sequence cbn-miR-54

Accession MIMAT0029687
Sequence

43 - 

uacccguaaucuucauaauccgag

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1