Stem-loop sequence cbn-mir-55

AccessionMI0024836 (change log)
DescriptionCaenorhabditis brenneri miR-55 stem-loop
Stem-loop
   --             -ga     ----     c 
5'   aggcggaaguaua   gggua    uacuu a
     |||||||||||||   |||||    |||||  
3'   uucgucuuuauau   cccau    augaa u
   ga             aug     auca     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig2: 2465352-2465412 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-55
cbn-mir-54Cbre_Contig2: 2465213-2465278 [+]
cbn-mir-55Cbre_Contig2: 2465352-2465412 [+]
cbn-mir-56Cbre_Contig2: 2465487-2465545 [+]
Database links

Mature sequence cbn-miR-55

Accession MIMAT0029688
Sequence

39 - 

uacccguauauauuucugcuuag

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1