Stem-loop sequence cbn-mir-56

AccessionMI0024837 (change log)
DescriptionCaenorhabditis brenneri miR-56 stem-loop
Stem-loop
   --    c  u     uc   u     -   a 
5'   cggc ga acauu  ugg guacc uca a
     |||| || |||||  ||| ||||| |||  
3'   gccg cu uguaa  gcc caugg agu a
   ga    c  u     -u   -     u   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig2: 2465487-2465545 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-56
cbn-mir-54Cbre_Contig2: 2465213-2465278 [+]
cbn-mir-55Cbre_Contig2: 2465352-2465412 [+]
cbn-mir-56Cbre_Contig2: 2465487-2465545 [+]
Database links

Mature sequence cbn-miR-56

Accession MIMAT0029689
Sequence

38 - 

uacccguaauguuuccgccgag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1