Stem-loop sequence cbn-mir-81

AccessionMI0024841 (change log)
DescriptionCaenorhabditis brenneri miR-81 stem-loop
Gene family MIPF0000154; mir-81
Stem-loop
   --c         cu      g   --  uau 
5'    gguuuucac  ugaucu aga  gc   c
      |||||||||  |||||| |||  ||   u
3'    ucgaaagug  acuaga ucu  cg   g
   uga         cu      g   au  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig0: 979011-979071 [-]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-81
cbn-mir-81Cbre_Contig0: 979011-979071 [-]
cbn-mir-82Cbre_Contig0: 976053-976113 [+]
Database links

Mature sequence cbn-miR-81

Accession MIMAT0029692
Sequence

40 - 

ugagaucaucgugaaagcuagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1