Stem-loop sequence cbn-mir-58a-2

AccessionMI0024843 (change log)
DescriptionCaenorhabditis brenneri miR-58a-2 stem-loop
Gene family MIPF0000282; mir-58
Stem-loop
   --    c    cuu  c        a   cgucc 
5'   ugcc uacu   cg aucucauc cuu     g
     |||| ||||   || |||||||| |||     c
3'   acgg auga   gc uagaguag gaa     c
   ua    c    cuu  -        -   uauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig688: 38441-38507 [-]
intergenic
Database links

Mature sequence cbn-miR-58a

Accession MIMAT0029693
Sequence

46 - 

ugagaucguucaguacggcaau

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1