Stem-loop sequence cbn-mir-239d-1

AccessionMI0024902 (change log)
DescriptionCaenorhabditis brenneri miR-239d-1 stem-loop
Gene family MIPF0000135; mir-239
Stem-loop
   -u      c  uu       a    uuuuu 
5'   uuguac ga  auaggca cuga     g
     |||||| ||  ||||||| ||||     a
3'   aacaug cu  uauccgu gacu     a
   au      a  -u       -    uuugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig205: 208242-208301 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-239d-1
cbn-mir-1824bCbre_Contig205: 202140-202207 [-]
cbn-mir-7638Cbre_Contig205: 203997-204059 [-]
cbn-mir-239c-1Cbre_Contig205: 208108-208173 [+]
cbn-mir-239d-1Cbre_Contig205: 208242-208301 [+]
cbn-mir-7626Cbre_Contig205: 209870-209926 [+]
cbn-mir-7615-1Cbre_Contig205: 210681-210744 [+]
Database links

Mature sequence cbn-miR-239d

Accession MIMAT0029730
Sequence

1 - 

uuuguaccgauuauaggcaacuga

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1