Stem-loop sequence cbn-mir-50

AccessionMI0024904 (change log)
DescriptionCaenorhabditis brenneri miR-50 stem-loop
Gene family MIPF0000266; mir-50
Stem-loop
   --u             uu  ug      uucc 
5'    gauaugucuggua  cu  gguuca    u
      |||||||||||||  ||  ||||||     
3'    cuaugcagauuau  ga  ccaagu    u
   cag             uu  --      cuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig18: 881172-881233 [-]
intergenic
Database links

Mature sequence cbn-miR-50

Accession MIMAT0029731
Sequence

1 - 

ugauaugucugguauucuuggguuc

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1