Stem-loop sequence cbn-mir-62

AccessionMI0024906 (change log)
DescriptionCaenorhabditis brenneri miR-62 stem-loop
Gene family MIPF0000296; mir-62
Stem-loop
   --           au      c  -   c 
5'   gugaguuagau  cguauc uu ccg u
     |||||||||||  |||||| || ||| u
3'   cauucgaucua  guauag aa ggu a
   ga           au      u  u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig32: 517267-517324 [-]
intergenic
Database links

Mature sequence cbn-miR-62

Accession MIMAT0029733
Sequence

37 - 

ugauauguaaucuagcuuacag

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1